You are looking at the HTML representation of the XML format.
HTML is good for debugging, but is unsuitable for application use.
Specify the format parameter to change the output format.
To see the non HTML representation of the XML format, set format=xml.
See the complete documentation, or API help for more information. 
<?xml version="1.0"?>
<api>
  <query>
    <pages>
      <page ns="0" title="API" missing="" />
      <page pageid="1" ns="0" title="Main Page">
        <revisions>
          <rev user="W2yw0r" timestamp="2018-05-18T15:11:24Z" comment="" contentformat="text/x-wiki" contentmodel="wikitext" xml:space="preserve">
&lt;sidebar&gt;

* Menu
** mainpage|mainpage-description
** Form:Sequence|Add Sequence
 
&lt;/sidebar&gt;

&lt;br /&gt;
&lt;br /&gt;

&lt;inputbox&gt;
align=left
type=search
width=50
searchbuttonlabel=Search
placeholder=e.g. Spinraza, Eteplirsen, DMD , TCAAGGAAGATGGCATTTCT ....
break=yes
bgcolor=#FFFFFF
&lt;/inputbox&gt;



Add your sequence and link it to your publication. 

{{#formlink:form=Sequence|link=none|link text=Add sequence|bgcolor=#FFFFFF|Add sequence&lt;/button&gt;
button text=Add sequence|link type=button|query string=|query string parameters|tooltip=}}



Search below for patented sequences, e.g GCCTCAGTCTGCTTCGCACC , DMD oligos etc..

&lt;html&gt;
&lt;iframe src=&quot;https://www.lens.org/lens/embed/search&quot; height=&quot;100px&quot; width=&quot;100%&quot; frameborder=0&gt;&lt;/iframe&gt;
&lt;/html&gt;



== General info about wikis ==
* [http://www.mediawiki.org/wiki/Manual:Configuration_settings Configuration settings list]
* [http://www.mediawiki.org/wiki/Manual:FAQ MediaWiki FAQ]
* [https://lists.wikimedia.org/mailman/listinfo/mediawiki-announce MediaWiki release mailing list]
* Consult the [http://meta.wikimedia.org/wiki/Help:Contents User's Guide] for information on using the wiki software.</rev>
        </revisions>
      </page>
    </pages>
  </query>
</api>